Id Trinity | FTRINITY_DN57251_c5_g1_i1 |
---|---|
Name Transcript | Ll_transcript_52501 |
Sequence | TATTTGGGTAACCCAAGTTTGATTCATGCCCAAAGTATCATTGCCATATGGGCTGCCCAAGTTATATTGATGGGTGTTGTTGAGGGTTTCAGAATTGCCG GTGGGCCTCTTGGCGAGGTCAATGACCCACTCTACCCTGGTGGTAGCTTTGACCCATAGGGTCTTGCTGATGACCCAGAGGCGTTTGCTGAGTTGAAGGT GAAGGAGâBLAST |
Tissue | flowers |
Gene name | LI_gene_67132; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_52501
Blastp | - |
---|---|
Blastx | Chlorophyll a-b binding protein 8, chloroplastic from Pisum with 89.86% of identity |
Eggnog | - |
Kegg | - |
CantataDB | Link to cantataDB annotations (CNT0000103) |
Mirbase | hbr-MIR6167 (MI0021475) |
Ncbi protein | Link to NCBI protein (XP_019447861.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |