Id Trinity | FTRINITY_DN57256_c1_g1_i6 |
---|---|
Name Transcript | Ll_transcript_54068 |
Sequence | GTGGTGCTTGCGTTGATGGAGTCTGATCTTCATCAAGTAATTAGGGCAAATGATGATCTTACTCCTGAGCACCACCAATTTTTCTTGTACCAACTTCTAC GGGGGTTGAAATTTTTACATACAGCAAATGTGTTTCATCGTGACCTGAAGCCAAAAAATATTCTTGCTAATGCGGATTGCAAACTAAAGATATGTGACTT CGGACTTGCTCGAGTTTCATTTAATGATGCTCCATCAGCTATATTCTGGACCGACTATGTTGCAACTCGGTGGTACCGTGCACCTGAACTATGTGGTTCT TTTTTCTCAAAATATACTCCCGCTâBLAST |
Tissue | flowers |
Gene name | LI_gene_67174; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_54068
Blastp | Mitogen-activated protein kinase 9 from Arabidopsis with 94.44% of identity |
---|---|
Blastx | Mitogen-activated protein kinase 9 from Arabidopsis with 94.44% of identity |
Eggnog | Mitogen-activated protein kinase(ENOG410XNY0) |
Kegg | Link to kegg annotations (AT3G18040) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_006584896.1) |
Pfam | Protein kinase domain (PF00069.24) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |