Ll_transcript_52915

• Id Trinity: FTRINITY_DN57293_c0_g2_i2
• Name Transcript: Ll_transcript_52915
• Sequence: GGCTTCCTTTGCACTCATGAAAAAATCACGGTCTGTGTCCTGGTTAATCTTCTCTAAACTTTGGCCAGTGTGATAGGACAGATATCCATTCAGGTTTGCC TTATGATGCAACATTTCATTTGCCTGAATATCTATGTCAGTTTGCCCTCCTTGTGCACCACCAAGCGGTTGATGAATCATTATCCTTGAATTTGGCAAGC TGTATCTCTTTCCTTTGGTCCCTGCGCTAAGCAGAAACGCTCCCATACTAGCTGCTAATCCAACACATACAGTGGATACATCAGGTCGGATATGCCTCAT TGTATCAAATATTGCCATACCAGCTGTAACTGATCCTCCGGGAGAATTTACATACATGACAATATCCTTGTTAGGATCAACAGCATCAAGGTAAAGGAGC TGAGCAACTATGATATTTGCCATATCATCATCAACTGCTCCACCAC
• Tissue: flowers
• Gene name: LI_gene_67498;
• Additional information: details;

Expression of Ll_transcript_52915

FPKM

• FPAB: 0
• FPNAB: 0.5
• LF1: 3.1
• LF2: 0.8
• LF3: 0.2
• LF4: 0.2
• UF1: 1.7
• UF2: 0.6
• UF3: 1.5
• UF4: 0.6

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_52915

• Blastp: ATP-dependent Clp protease proteolytic subunit 5, chloroplastic from Arabidopsis with 98.65% of identity
• Blastx: ATP-dependent Clp protease proteolytic subunit 5, chloroplastic from Arabidopsis with 98.65% of identity
• Eggnog: Cleaves peptides in various proteins in a process that requires ATP hydrolysis. Has a chymotrypsin-like activity. Plays a major role in the degradation of misfolded proteins (By similarity)(COG0740)
• Kegg: Link to kegg annotations (AT1G02560)
• CantataDB: Link to cantataDB annotations (CNT0001990)
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019452338.1)
• Pfam: Clp protease (PF00574.22)
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;