Id Trinity | FTRINITY_DN57293_c0_g2_i2 |
---|---|
Name Transcript | Ll_transcript_52915 |
Sequence | GGCTTCCTTTGCACTCATGAAAAAATCACGGTCTGTGTCCTGGTTAATCTTCTCTAAACTTTGGCCAGTGTGATAGGACAGATATCCATTCAGGTTTGCC TTATGATGCAACATTTCATTTGCCTGAATATCTATGTCAGTTTGCCCTCCTTGTGCACCACCAAGCGGTTGATGAATCATTATCCTTGAATTTGGCAAGC TGTATCTCTTTCCTTTGGTCCCTGCGCTAAGCAGAAACGCTCCCATACTAGCTGCTAATCCAACACATACAGTGGATACATCAGGTCGGATATGCCTCAT TGTATCAAATATTGCCATACCAGCTGTAACTGATCCTCCGGGAGAATTTACATACATGACAATATCCTTGTTAGGATCAACAGCATCAAGGTAAAGGAGC TGAGCAACTATGATATTTGCCATATCATCATCAACTGCTCCACCAC BLAST |
Tissue | flowers |
Gene name | LI_gene_67498; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_52915
Blastp | ATP-dependent Clp protease proteolytic subunit 5, chloroplastic from Arabidopsis with 98.65% of identity |
---|---|
Blastx | ATP-dependent Clp protease proteolytic subunit 5, chloroplastic from Arabidopsis with 98.65% of identity |
Eggnog | Cleaves peptides in various proteins in a process that requires ATP hydrolysis. Has a chymotrypsin-like activity. Plays a major role in the degradation of misfolded proteins (By similarity)(COG0740) |
Kegg | Link to kegg annotations (AT1G02560) |
CantataDB | Link to cantataDB annotations (CNT0001990) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019452338.1) |
Pfam | Clp protease (PF00574.22) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |