| Id Trinity | FTRINITY_DN57293_c0_g4_i1 |
|---|---|
| Name Transcript | Ll_transcript_52897 |
| Sequence | CCTAACAAGGATATTGTCATGTACGTAAATTCTCCAGGAGGATCAGTTACAGCTGGTAATAAATATTTTATGGAACTCTATCTCGCATTATTTCATTGTT TTGATGTACATGTGGACTGAAAAAGAGTATTATTGTTATATTGTATCCAAAAAACGAATCGCCTCATACTTCTCTCTCTAGGTATGGCAATATTTGATAC AATGAGGCATATCCGACCTGATGT BLAST |
| Tissue | flowers |
| Gene name | LI_gene_67500; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_52897
| Blastp | - |
|---|---|
| Blastx | ATP-dependent Clp protease proteolytic subunit 5, chloroplastic from Arabidopsis with 41.89% of identity |
| Eggnog | Cleaves peptides in various proteins in a process that requires ATP hydrolysis. Has a chymotrypsin-like activity. Plays a major role in the degradation of misfolded proteins (By similarity)(COG0740) |
| Kegg | Link to kegg annotations (AT1G02560) |
| CantataDB | Link to cantataDB annotations (CNT0001990) |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019441289.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |