Id Trinity | FTRINITY_DN57294_c1_g5_i1 |
---|---|
Name Transcript | Ll_transcript_54408 |
Sequence | GCCAATCTTCATTGGGGTAGTCCTTCCTTATGGCTTCAGCTGTTTGTAGCAAGTGCTCAATCTGAGGCTCATCCAAATCAGGATCACTCTCATCCACTAC TTCATTAAGGAGTTCACAACATTCCCATATACTCATTTCCACCCTCTTCAATTTTCCATACTCCTCCCTCATTTTCCTCACAAAATCAATTGATTGGTTA ATG BLAST |
Tissue | flowers |
Gene name | LI_gene_67511; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_54408
Blastp | - |
---|---|
Blastx | Inositol oxygenase 4 from Arabidopsis with 85.07% of identity |
Eggnog | inositol oxygenase(ENOG410XQ4J) |
Kegg | Link to kegg annotations (AT4G26260) |
CantataDB | Link to cantataDB annotations (CNT0001464) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019424845.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |