Id Trinity | FTRINITY_DN57524_c3_g1_i8 |
---|---|
Name Transcript | Ll_transcript_130585 |
Sequence | GTTATTTCATAGGAAAACAGTGGTGCTATGTTGAAAAAGGAAATAAGGAAATCCCATTCCATGAAGCACGGAATCACCATTTCATTTTTTTGCTAACATG GGATTGAGATTTTCTCATTCCTGAAATGAGCATGGGATGGATTCATCATTCCTATGTGGCATTGAAAACGTTGATAGTCGTCCACAGATTATTGAGGGAG GGCGATCCTACTTTTAGAGAGGAACTTCTGAATTTCTCACAGCGAGGACGCATACTTCAACTTTCTAATTTCAAGGATGATTCTAGCCCAATTGCGTGGG ATTGCTCTGCCTGGGTACGTACTTATGCATTATTTTTAGAAGAAAGGCTTGAATGTTTCCGCATTCTGAACTATGATATTGAAGCCGAACGTTTAAGCAA GCCTTCCGAACGGCAGGATGATAAGGGGTACAGCAAGACCAGGGATCTGGATAGCGAGGAGCTATTGGAGCAGTTGCCTGCTTTGCAACAGCTGCTTTAT CGTCTTGTTGGTTGTCGG BLAST |
Tissue | flowers |
Gene name | LI_gene_69403; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_130585
Blastp | Putative clathrin assembly protein At2g01600 from Arabidopsis with 89.26% of identity |
---|---|
Blastx | Putative clathrin assembly protein At2g01600 from Arabidopsis with 89.26% of identity |
Eggnog | Clathrin assembly protein(ENOG410XQ90) |
Kegg | Link to kegg annotations (AT2G01600) |
CantataDB | Link to cantataDB annotations (CNT0000240) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019464583.1) |
Pfam | ANTH domain (PF07651.15) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |