| Id Trinity | FTRINITY_DN57570_c0_g3_i4 |
|---|---|
| Name Transcript | Ll_transcript_130494 |
| Sequence | CAAGTGGGTGAGATGTCCACCATTTCATGTACCATGTACATTTGTCTTATTTTATTGTTATTTAAGGTTTTAACGATAAATTGTATATATATGTTTCTCC AGGTGATGGTTGATTCGCTGGGGCAAAGCAAGGGCTCTGGTTTTGTGGCCTTTTCTACTCCTGAGGAAGCAAATAAAGCTTTGAATGAAATGAATGGAAA GTTGATTGGACGGAAGCCTCTGTATGTTGCTGTGGCCCAGCGCAAAGAAGAAAGGAAGGCTCGTTTGCAGGCTCAGTTTTCGCAAATCCAAGCGCCAGGT GCAATTGCACCTCTTCCTGCAGGAATTCCTGGATATCATCCCGGGGCACCAAGATTTGCCCCTCAACAGTTGTAC BLAST |
| Tissue | flowers |
| Gene name | LI_gene_69773; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_130494
| Blastp | Polyadenylate-binding protein 5 from Arabidopsis with 56.99% of identity |
|---|---|
| Blastx | Polyadenylate-binding protein 8 from Arabidopsis with 57.61% of identity |
| Eggnog | poly(A) binding protein, cytoplasmic(ENOG410XR5X) |
| Kegg | Link to kegg annotations (AT1G71770) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019449781.1) |
| Pfam | RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) (PF00076.21) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |