Id Trinity | FTRINITY_DN57588_c2_g1_i6 |
---|---|
Name Transcript | Ll_transcript_131923 |
Sequence | GTCCGACTCGTAATTCACTTCTGACTCCGTGTTCGATAGCCTGACCGTAGTGATGTTAATTGTGGTTACATTCATAAGTAGCTTGGTCCATCTTTATTCC ATTTCATATATGTCTGAGGATCCGCATAGCCCTCGATTTATGTGTTATTTATCCATTTTTACTTTTTTTATGCTAATGTTGGTGACTGGAGATAACTTTC TTCAATTATTCCTGGGATGGGAGGGAGTAGGTCTTGCTTCATATTTGTTAATTCATTTCTGGTTTACACGACTTCAGGCAGATAAAGCAGCTATAAAAGC TATGCTTGTCAATCGAGTAGGTGATTTTGGATTAGCTCCTGGGATTTCGGGTCGTTTTACTCTCTTTCAAACAGTAGACTTTTCAACCATTTTTGCTCGT GCTAGTGCCCCCAGAAATTCTTGGATTTTTT BLAST |
Tissue | flowers |
Gene name | LI_gene_69940; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_131923
Blastp | NADH-ubiquinone oxidoreductase chain 5 from Triticum with 96.03% of identity |
---|---|
Blastx | NADH-ubiquinone oxidoreductase chain 5 from Triticum with 96.15% of identity |
Eggnog | - |
Kegg | - |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (YP_009237614.1) |
Pfam | NADH-Ubiquinone oxidoreductase (complex I), chain 5 N-terminus (PF00662.19) |
Rfam | Intron_gpII (RF00029) |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |