| Id Trinity | FTRINITY_DN57597_c4_g2_i10 |
|---|---|
| Name Transcript | Ll_transcript_133357 |
| Sequence | TCTCATGGTCCTATTCATTTCCGTGCTCCTTCCAAGATTTTCTGGCGCACTGTTCGTGGGTAATGATTTTATCTTTTCAATTTTCTGTCTTTTTTGTATT TTAAATGTTGGGTTGTTGTTAATTTTTGTTATTAATGTTGGGTTCTTGTAAATTTTTGTTTTTACTTTTCTATTTCTGAATCTCTATGTGGATTCGATAT TGTGAGGTACAAATGTTTTTATTGTTTCTTAAATGTTTTGTTTTGTTTTGGTTTTTATTGTTTTTTGTATTGTTTTAAAATGAAATTTGCACTGTCATTG GAATGAATATTGCTGATTTTTACTTATTGAAGCAAACTAGATTGAACAGTTTGAATGAATAAAAAATCCACCCTTCCGAGCAGATGATTTTGAGAATAAA AAATCCACCCTTCCGAGCAGATGATTTTGAGAAT BLAST |
| Tissue | flowers |
| Gene name | LI_gene_70012; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_133357
| Blastp | - |
|---|---|
| Blastx | 60S ribosomal protein L13a-1 from Arabidopsis with 100% of identity |
| Eggnog | This protein is one of the early assembly proteins of the 50S ribosomal subunit, although it is not seen to bind rRNA by itself. It is important during the early stages of 50S assembly (By similarity)(COG0102) |
| Kegg | Link to kegg annotations (AT3G07110) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019414301.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |