| Id Trinity | FTRINITY_DN57610_c0_g1_i10 |
|---|---|
| Name Transcript | Ll_transcript_147907 |
| Sequence | GGATTATGTTGTCATTAGACTTACGTGTTGAGGATTATGTTGTCATTACATTTACACCCCTTGTGAAATAAACCTCAAAGTTTTGTTTGGATATTTATTG ATGGGTGAAATGGATTGTGATGTCATTACGCTTACGCGTTGATGATTGTGTTATCCATAAGCAAAAGAGAGACAGCCCTGACAAAGTTACACCGATGCTG GCATATTACATCTTGGATGGTTCAATATACCAGGCACCACAACTATGCAATGTTTTTGCTGCTCGAATAGGAAGGACACTCCATCATATACAAAAGGCTT TTACTATAGCTGCCTCAAAATTGGAGAAGATAGGATATGAGTAATGAATGTTCAGAAATTACTAATCGAATCGAAGCAAATAAATGTTAAGAATCGAAAT ATGGCACCATTGCTTCAACATTTTTGCAATAAAGTACATAGGAGTGATTTAAATTGTAGATAGTATTGGACCACAATACGAT BLAST |
| Tissue | flowers |
| Gene name | LI_gene_70132; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_147907
| Blastp | - |
|---|---|
| Blastx | Mediator of RNA polymerase II transcription subunit 6 from Arabidopsis with 77.05% of identity |
| Eggnog | component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors (By similarity)(COG5097) |
| Kegg | Link to kegg annotations (AT3G21350) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019430318.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |