Id Trinity | FTRINITY_DN57689_c1_g3_i2 |
---|---|
Name Transcript | Ll_transcript_150365 |
Sequence | AAATTTGTTATTTGAAGAGCTATGTTTTTTGGTTTGTATTATGCTGCTTCAAGTTTGGATTTGTGTTGGATTTGCAGAGCAAGGCTAAAGAGATGGTGAT GCTAGCAGAAAAAATGAGGACACAACTTTTGTCTGGCTCAAGTTCTCAAGCTAATACAACTGGTGATGAGCAGATGGGTTCAAAGGAAGAGATGCAAGAA TTGTTATTGAGTGTTGGTATTATATCCCCTGTCACCAAAGAGTCCGCAGGTGCTTTGTATCATCAACAGCTATCTCGTCAGTTGGCAGATTTTGTCAAAG TTCCACTTGAGAGAGCTGGAGGAATCATCAATCTTATTGATATTTATTGTCTATTCAATCGTGCT BLAST |
Tissue | flowers |
Gene name | LI_gene_70772; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_150365
Blastp | Vacuolar protein sorting-associated protein 36 from Arabidopsis with 75.51% of identity |
---|---|
Blastx | Vacuolar protein sorting-associated protein 36 from Arabidopsis with 75.51% of identity |
Eggnog | vacuolar protein sorting(ENOG410XR74) |
Kegg | Link to kegg annotations (AT5G04920) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019449356.1) |
Pfam | EAP30/Vps36 family (PF04157.15) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |