| Id Trinity | FTRINITY_DN57689_c1_g3_i2 |
|---|---|
| Name Transcript | Ll_transcript_150365 |
| Sequence | AAATTTGTTATTTGAAGAGCTATGTTTTTTGGTTTGTATTATGCTGCTTCAAGTTTGGATTTGTGTTGGATTTGCAGAGCAAGGCTAAAGAGATGGTGAT GCTAGCAGAAAAAATGAGGACACAACTTTTGTCTGGCTCAAGTTCTCAAGCTAATACAACTGGTGATGAGCAGATGGGTTCAAAGGAAGAGATGCAAGAA TTGTTATTGAGTGTTGGTATTATATCCCCTGTCACCAAAGAGTCCGCAGGTGCTTTGTATCATCAACAGCTATCTCGTCAGTTGGCAGATTTTGTCAAAG TTCCACTTGAGAGAGCTGGAGGAATCATCAATCTTATTGATATTTATTGTCTATTCAATCGTGCT BLAST |
| Tissue | flowers |
| Gene name | LI_gene_70772; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_150365
| Blastp | Vacuolar protein sorting-associated protein 36 from Arabidopsis with 75.51% of identity |
|---|---|
| Blastx | Vacuolar protein sorting-associated protein 36 from Arabidopsis with 75.51% of identity |
| Eggnog | vacuolar protein sorting(ENOG410XR74) |
| Kegg | Link to kegg annotations (AT5G04920) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019449356.1) |
| Pfam | EAP30/Vps36 family (PF04157.15) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |