Id Trinity | FTRINITY_DN57719_c2_g1_i2 |
---|---|
Name Transcript | Ll_transcript_216087 |
Sequence | GGAAATTTGTGGCGACCACGTTTTGGCATATAGCGCCACAATGCAAATTTTCGTGAAAACTCTCACCGGCAAGACCATCACCCTCGAGGTCGAGCCATCA GACACAATCGAAAATGTTAAGGCTAAAATCCAAGATAAGGAAGGTATTCCCCCAGATCAGCAACGTCTGATCTTTGCTGGTAAACAATTGGAAGATGGCA GAACACTCTCAGACTACAACATCCAGAAGGAGTCTACCCTCCATTTGGTGCTCCGTTTGAGAGGAGGTATCATTGAGCCTTCCCTTCGTATCTTGGCTCA AAAGTATAACTGTGACAAGATGATTTGCCGTAAATGCTACGCTAGATTGCACCCACGTGCCACCAATTGCAGGAAGACCAAGTGCGGACACACAAACAAT CTCCGCCCAAAGAAGAAGTTAAGTAGATGGTTTATTTCTATCTCTTCAACTACTCAACAGGTATTTATCCTGTTTGTTATAACATCTTATGTATTTGAAG TTCAATâBLAST |
Tissue | flowers |
Gene name | LI_gene_71056; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_216087
Blastp | Ubiquitin-60S ribosomal protein L40 from Sophophora with 99.21% of identity |
---|---|
Blastx | Ubiquitin-60S ribosomal protein L40 from Sophophora with 99.21% of identity |
Eggnog | Ribosomal protein(COG1552) |
Kegg | Link to kegg annotations (Dmel_CG2960) |
CantataDB | Link to cantataDB annotations (CNT0000474) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_007162922.1) |
Pfam | Ubiquitin-2 like Rad60 SUMO-like (PF11976.7) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |