| Id Trinity | FTRINITY_DN57719_c2_g1_i2 |
|---|---|
| Name Transcript | Ll_transcript_216087 |
| Sequence | GGAAATTTGTGGCGACCACGTTTTGGCATATAGCGCCACAATGCAAATTTTCGTGAAAACTCTCACCGGCAAGACCATCACCCTCGAGGTCGAGCCATCA GACACAATCGAAAATGTTAAGGCTAAAATCCAAGATAAGGAAGGTATTCCCCCAGATCAGCAACGTCTGATCTTTGCTGGTAAACAATTGGAAGATGGCA GAACACTCTCAGACTACAACATCCAGAAGGAGTCTACCCTCCATTTGGTGCTCCGTTTGAGAGGAGGTATCATTGAGCCTTCCCTTCGTATCTTGGCTCA AAAGTATAACTGTGACAAGATGATTTGCCGTAAATGCTACGCTAGATTGCACCCACGTGCCACCAATTGCAGGAAGACCAAGTGCGGACACACAAACAAT CTCCGCCCAAAGAAGAAGTTAAGTAGATGGTTTATTTCTATCTCTTCAACTACTCAACAGGTATTTATCCTGTTTGTTATAACATCTTATGTATTTGAAG TTCAATâBLAST |
| Tissue | flowers |
| Gene name | LI_gene_71056; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_216087
| Blastp | Ubiquitin-60S ribosomal protein L40 from Sophophora with 99.21% of identity |
|---|---|
| Blastx | Ubiquitin-60S ribosomal protein L40 from Sophophora with 99.21% of identity |
| Eggnog | Ribosomal protein(COG1552) |
| Kegg | Link to kegg annotations (Dmel_CG2960) |
| CantataDB | Link to cantataDB annotations (CNT0000474) |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_007162922.1) |
| Pfam | Ubiquitin-2 like Rad60 SUMO-like (PF11976.7) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |