Id Trinity | FTRINITY_DN57729_c5_g1_i2 |
---|---|
Name Transcript | Ll_transcript_216202 |
Sequence | ATCGCTTATTGATCCAAAGAAGAATTGGTTAGCTGCTCTACACATGAAAACTATATCCAGACGCCTCCGCAATTATGGTTTTTATTCCTCAAACCCTAAT TCTTCCATTTTCACCGTTTCACCACATTCATTTGTTTATTATGTAATTTTTTTGTGAATTAGGGCTCCGATACGATGATCTATACGATCCGTATTACGAT ATTGATGTGCAGGAAGCACTGAATCGGCTTCCAAAGGAGGTGGTGGAAGCACGTCATCAGCGTCTAAAGCGCGCTATTGACCTTTCAATGAAGCACCAGT ATCTACCTCAAGATCTTCAAGâBLAST |
Tissue | flowers |
Gene name | LI_gene_71150; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_216202
Blastp | - |
---|---|
Blastx | Cytochrome b-c1 complex subunit 7 from Solanum with 79.25% of identity |
Eggnog | component of the ubiquinol-cytochrome c reductase complex (complex III or cytochrome b-c1 complex), which is part of the mitochondrial respiratory chain (By similarity)(ENOG4111V1G) |
Kegg | Link to kegg annotations (102598697) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019416722.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |