Ll_transcript_216194

• Id Trinity: FTRINITY_DN57729_c5_g4_i5
• Name Transcript: Ll_transcript_216194
• Sequence: CAGCTCACTGCTTTATAAGGAGGTGAGAATCAAACTATCCTTACTATTCCAGAACTCTTCAACTCTTATGTTCACTTGTACATGTGCTGATACTAGTCTA ACTTATGGAGCAGGAATTCGAAAAGATGAAGGAGAAATCACCCGAAAACTTCAGGCTTGACTTCGCTGTGAGCAGAGAACAAACAAACGAAAAAGGCGAG AAGATGTACATTCAAACCCGAATGGCCGAATATGCAGAAGAGCTATGGGA
• Tissue: flowers
• Gene name: LI_gene_71154;
• Additional information: -

Expression of Ll_transcript_216194

FPKM

• FPAB: 0
• FPNAB: 0
• LF1: 0.8
• LF2: 1.3
• LF3: 0
• LF4: 0
• UF1: 0.4
• UF2: 1.4
• UF3: 0
• UF4: 0.8

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_216194

• Blastp: -
• Blastx: Ferredoxin--NADP reductase, leaf isozyme, chloroplastic from Oryza sativa with 77.55% of identity
• Eggnog: Component of the sulfite reductase complex that catalyzes the 6-electron reduction of sulfite to sulfide. This is one of several activities required for the biosynthesis of L- cysteine from sulfate. The flavoprotein component catalyzes the electron flow from NADPH - FAD - FMN to the hemoprotein component (By similarity)(COG0369)
• Kegg: Link to kegg annotations (4339874)
• CantataDB: Link to cantataDB annotations (CNT0000152)
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_003520228.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;