Id Trinity | FTRINITY_DN57735_c0_g3_i6 |
---|---|
Name Transcript | Ll_transcript_214407 |
Sequence | CCAATTATGTCTTTTGATCAAAATGAAGATGCTATTGTGGGCTCTCTCAAGCATAGCTTGAGGCAACTAGAAACTCTGGGAGCTGAAAGGGCTGGTCTTG AAGACATGCTTAAAGAGATGAAAAGAAAGGATGATATACTGCCCAAGTTGATGACATTCTCTGGTTCTCATGAGGATCTTTTCAAAAAGGAGATATCGAA ATATGATCATATTTGTGAAGAAATAGGTCAAAATATTGAGGCACAAGAGCAGTTGTTAGTGCACATCCAGGTTCAAAATCATGATTTCTCTGTTATCTTC AATCTTGACGATTACAAAGTTTCACGTGAAAAATCATACAAGCAGATTGAA BLAST |
Tissue | flowers |
Gene name | LI_gene_71195; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_214407
Blastp | Vacuolar-sorting protein BRO1 from Arabidopsis with 77.78% of identity |
---|---|
Blastx | Vacuolar-sorting protein BRO1 from Arabidopsis with 77.78% of identity |
Eggnog | Rhophilin, Rho GTPase binding protein(ENOG410XQX6) |
Kegg | Link to kegg annotations (AT1G15130) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019428016.1) |
Pfam | ALIX V-shaped domain binding to HIV (PF13949.5) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |