| Id Trinity | FTRINITY_DN57812_c2_g1_i7 |
|---|---|
| Name Transcript | Ll_transcript_56081 |
| Sequence | AAATTTAGTTGTTCAGATGTGTAGTTTAATTTTTTATTTACTTATTCATATATAAAGCAGGTACGCTTGCCAGATAGTACAAGAATATCAGATGCTGATG TACAGATCTCCCGTCAGTGTATTTCTGCATTTCTGTCTATGCATACAGCTTATGAATTGCTTCCTGAGTCAGGCAAGGTTGTTGCCTTGGATATTGAACT GCCTGTGAAGCAGGCATTTCATATACTGCATGAGCAGGGAATTTACGTGGCTCCACTTTGGGATTTCGGCAAGGGGAAATTTGTTGGTGTTCTTAGTGCT TCAGATTTTATTTTAATTTTAAGAGAGATAGGGAATCATGGGTCTAATCTGACAGAGGAGGAGCTTGAAACACATACCATATCAGCTTGGAAAGAAGGAA AATCATATCTAAATAGACAGAATAATGGTCGTGGAACTGTATTTTCAAGAGGTTTTATCCATGCTGGACCAAATGATAACCTGAATGCTATTGCCATGAA GATCTTGCAAAAGGAGGTTTCAACTGTTCCTATTGTCCATTCATCTTCTGAGGATGGCTCATTTCCGCAGTTACTACATCTCGCTTCACTTTCAGGAATA TTGAAATGCATTTGCAGGTATTTTAGGCATTGTCCTAGTT BLAST |
| Tissue | flowers |
| Gene name | LI_gene_71858; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_56081
| Blastp | Sucrose nonfermenting 4-like protein from Arabidopsis with 71.69% of identity |
|---|---|
| Blastx | Sucrose nonfermenting 4-like protein from Arabidopsis with 68.82% of identity |
| Eggnog | Catalyzes the conversion of inosine 5'-phosphate (IMP) to xanthosine 5'-phosphate (XMP), the first committed and rate- limiting step in the de novo synthesis of guanine nucleotides, and therefore plays an important role in the regulation of cell growth (By similarity)(COG0517) |
| Kegg | Link to kegg annotations (AT1G09020) |
| CantataDB | Link to cantataDB annotations (CNT0002298) |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019425810.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |