Ll_transcript_258427

• Id Trinity: FTRINITY_DN57938_c1_g1_i12
• Name Transcript: Ll_transcript_258427
• Sequence: ACTTAATTGACAGAAATTTCAATTTTCGAAGGGTCCAAATGAGGTTTCCTTGCAGGAGTACAAATGATGGTTTGGGCGAGAAGACCCACCACTTCACATT ACTTGATGGTGAGATGGTTATTGATACATTGCCAGATTCAAATAAGCAGGAGAGAAGATACCTTATATATGATATGATGGCAATCAACCAAGTATCCATA ATAGAGCGACCCTTCTATGA
• Tissue: flowers
• Gene name: LI_gene_72888;
• Additional information: -

Expression of Ll_transcript_258427

FPKM

• FPAB: 35.2
• FPNAB: 26.5
• LF1: 30.2
• LF2: 21.2
• LF3: 14.1
• LF4: 19.6
• UF1: 23.3
• UF2: 17.8
• UF3: 15
• UF4: 19.4

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_258427

• Blastp: -
• Blastx: mRNA-capping enzyme subunit alpha from Kluyveromyces with 39.73% of identity
• Eggnog: Second step of mRNA capping. Transfer of the GMP moiety of GTP to the 5'-end of RNA via an enzyme-GMP covalent reaction intermediate (By similarity)(COG5226)
• Kegg: Link to kegg annotations (KLLA0B02200g)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019432012.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;