Id Trinity | FTRINITY_DN57982_c0_g2_i31 |
---|---|
Name Transcript | Ll_transcript_258579 |
Sequence | AGTCAGTTGCAGCCTCAGATGTTAACCTCTTTGCCACAATGGCTGGGTCTCAGACATTGCCATTGCAAAAAGACCTGCCACCAAATTCGGCATACACATC AGCTGGTCATCATGAGAACTGGGGAGAGTCCAGCATGGCAGATGCAAGCCCTATGACCGATTCTTCAACAGATGATACTGATGATAAAAATCAAAGGACA TTAAGACGGCTAGCTCAAAATCGGGAGGCTGCCAGAAAAAGCAGACTGAAGAAAAAGGCATATGTTCAACAATTAGAGAGTAGTAGACTGAAACTGACCC AACTTGA BLAST |
Tissue | flowers |
Gene name | LI_gene_73271; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_258579
Blastp | TGACG-sequence-specific DNA-binding protein TGA-2.1 from Nicotiana with 59.05% of identity |
---|---|
Blastx | TGACG-sequence-specific DNA-binding protein TGA-2.1 from Nicotiana with 51.67% of identity |
Eggnog | - |
Kegg | Link to kegg annotations (107782457) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019429722.1) |
Pfam | bZIP transcription factor (PF00170.20) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |