| Id Trinity | FTRINITY_DN57996_c1_g3_i1 |
|---|---|
| Name Transcript | Ll_transcript_260233 |
| Sequence | CTCCTTATTAATGCAATTTTATCATCAATTTGCAAACATCGATATAACAAATTATCCAGAACATATTCGAATAAAAGATCATACCATTGAATCCTTGACC TTAGCTATGTATTGCTTCAAAGCACAATCTCCACGAAGAATTTTTCCTCCACATCCAGGTACATTTACTGATCCTACCGACTCCTCATCAACAACAACCG CGTCAACCCGGTCAGTTCCTGTCTTAATATCGGGAATCTCAAACATGGCTTCGGTTAAAATGCTTTCGAGTAGGGCTCTTAAACCCC BLAST |
| Tissue | flowers |
| Gene name | LI_gene_73389; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_260233
| Blastp | - |
|---|---|
| Blastx | CLP protease regulatory subunit CLPX3, mitochondrial from Arabidopsis with 65.62% of identity |
| Eggnog | ATP-dependent specificity component of the Clp protease. It directs the protease to specific substrates. Can perform chaperone functions in the absence of ClpP (By similarity)(COG1219) |
| Kegg | Link to kegg annotations (AT1G33360) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019449440.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |