| Id Trinity | FTRINITY_DN57998_c1_g1_i2 |
|---|---|
| Name Transcript | Ll_transcript_258608 |
| Sequence | CTTATTTTGTTAAGAACGACCTTAAGAATAAGAACTGTGAGTGCTCTTAAGTTGCTCGGTTAGTCGTGTTATTATTTATGATGATACAATTGAATGATCA TTTTTGTAAAATTGGAAAAACACAGAGTTGATAAACGTTGGGCAGAAGCAAGATGCTTTGCAGACACTTCACGACCTCATTACTTCGAAAAGGTACCGAG CATGGCAGAAGACACT BLAST |
| Tissue | flowers |
| Gene name | LI_gene_73405; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_258608
| Blastp | - |
|---|---|
| Blastx | Eukaryotic translation initiation factor 3 subunit A from Arabidopsis with 93.33% of identity |
| Eggnog | Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome (By similarity)(ENOG410XQ37) |
| Kegg | Link to kegg annotations (AT4G11420) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_003554329.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |