Ll_transcript_136788

• Id Trinity: FTRINITY_DN58036_c0_g1_i8
• Name Transcript: Ll_transcript_136788
• Sequence: ATTAGCGTGATTTGTTGATCGTAAGTGGTCAAGTTGGGTGGTCTCTAACCGCTTTGTCTAGTGCCCAATGCCAGGTTGCATCTATGGTACTTATATCTTG GTTCAAGGAGATAAAGAGCATTTATTCATCCAAAAACCTCAATGGTATTTATTCCTGGTGCCCTCAAAGATTGGTTGCTGCACTTATTAGGATGTACTGA CCCTGCATTCCCAACAAAAGGGGAAATCCTAAGTTTAATTTTCATA
• Tissue: flowers
• Gene name: LI_gene_73641;
• Additional information: -

Expression of Ll_transcript_136788

FPKM

• FPAB: 11.4
• FPNAB: 4.8
• LF1: 1.6
• LF2: 14.4
• LF3: 5.3
• LF4: 0
• UF1: 0
• UF2: 8.3
• UF3: 12.7
• UF4: 2.4

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_136788

• Blastp: -
• Blastx: TATA-binding protein-associated factor BTAF1 from Arabidopsis with 62.96% of identity
• Eggnog: excision repair cross-complementing rodent repair deficiency complementation group(ENOG410XP4Z)
• Kegg: Link to kegg annotations (AT3G54280)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019412827.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;