Ll_transcript_134425

• Id Trinity: FTRINITY_DN58064_c3_g1_i4
• Name Transcript: Ll_transcript_134425
• Sequence: ATACCACTTGGACAATACCTTGGATGGTTTATACATTGCTCCTGCTTTTATGGACAAGCTTGTTGTTCACATCACCAAGAACTTCATGACACTGCCCAAC ATCAAGGTTCCTCTCATTCTTGGTGTCTGGGGAGGGAAAGGTCAAGGAAAATCTTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGAATCAACCCTATCA TGATGAGTGCTGGAGAGTTGGAAAGTGGAAATGCTGGAGAGCCAGCGAAATTGATAAGGCAAAGGTACCGCGAAGCTGCAGATATAATAAAGAAGGGGAA GATGTGTGCCCTCTTCATCAATGATCTCGATGCAGGAGCTGGTCGTATGGGTGGAACCACACAATACACTGTGAACAACCAGATGGT
• Tissue: flowers
• Gene name: LI_gene_73854;
• Additional information: details;

Expression of Ll_transcript_134425

FPKM

• FPAB: 1
• FPNAB: 2.3
• LF1: 7.6
• LF2: 5.3
• LF3: 5.7
• LF4: 4.1
• UF1: 6.2
• UF2: 5.2
• UF3: 6.5
• UF4: 5.3

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_134425

• Blastp: Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic from Oryza sativa with 97.32% of identity
• Blastx: Ribulose bisphosphate carboxylase/oxygenase activase 2, chloroplastic from Larrea with 92.97% of identity
• Eggnog: 26S protease regulatory subunit(COG1222)
• Kegg: Link to kegg annotations (4351224)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019433087.1)
• Pfam: ATPase family associated with various cellular activities (AAA) (PF00004.28)
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;
  Links to GO: General; Genes and gene products; Annotations; Ontology;