Ll_transcript_79793

• Id Trinity: FTRINITY_DN58142_c0_g1_i3
• Name Transcript: Ll_transcript_79793
• Sequence: GGTAAAAACAAGGCGTAGAAAGGTATAGTTTTTGCTTTGTTTTGGGCAGTCACCTACTATTATTAAGTTTTACTCTTTTTTATCCTTTTGTGAGATAAAA TTGAAAACAAAAGAAAATATCTTTTAATAGAAAACAGGGTATGGAACTTAGAAATGTTACAGAGAATTTTTGCCTATGCAGTAAATCGCTTTCCTTCTTG CAGGGAATGAGTGAAGACGTAAGCATAGGTAAATTCTTCGATGAGGCTATGATGGTGGAACTGGCACAGCAGGC
• Tissue: flowers
• Gene name: LI_gene_74574;
• Additional information: -

Expression of Ll_transcript_79793

FPKM

• FPAB: 0.3
• FPNAB: 1
• LF1: 0
• LF2: 0
• LF3: 0.4
• LF4: 0.3
• UF1: 0
• UF2: 0.7
• UF3: 0
• UF4: 0.3

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_79793

• Blastp: -
• Blastx: 109 kDa U5 small nuclear ribonucleoprotein component GFL from Arabidopsis with 87.5% of identity
• Eggnog: Catalyzes the GTP-dependent ribosomal translocation step during translation elongation. During this step, the ribosome changes from the pre-translocational (PRE) to the post- translocational (POST) state as the newly formed A-site-bound peptidyl-tRNA and P-site-bound deacylated tRNA move to the P and E sites, respectively. Catalyzes the coordinated movement of the two tRNA molecules, the mRNA and conformational changes in the ribosome (By similarity)(COG0480)
• Kegg: Link to kegg annotations (AT5G25230)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_003609507.2)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;