Id Trinity | FTRINITY_DN58160_c1_g1_i10 |
---|---|
Name Transcript | Ll_transcript_80029 |
Sequence | TGTGACAAGTCTCTCACATCCAACTTCCTCATATAGAGCATCATGGTGAATTCTCTTAGTGGATGGTTTTACTTGTAAACTGCTTTTAATTGCAACAAAG TTGTATCTCCCAAAAATCAACAGATCAAGTGGTGCTGTTATAGATATGTGGATTGAGGCAAAAGAGCTGGAGGCAAATACAATGTGATAGATTTGATCAT GATCACAACATTCTCTATAGCACTCCTTTGTGTCACTTTTCCCTTTTATGATGTGCTTCATTTGACACCGTAGGTTGTGTCTACAAATTATCTAATCTTT CATAATTGTAGTTTACTTGTTTTTAGTGTTCACATGTGAGAAGTGAACAATTGCATAGTAGAAATGATGGATGAAATTACTCTTTCCAAAATGGG BLAST |
Tissue | flowers |
Gene name | LI_gene_74681; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_80029
Blastp | - |
---|---|
Blastx | ATP-dependent Clp protease proteolytic subunit-related protein 1, chloroplastic from Arabidopsis with 83.33% of identity |
Eggnog | Cleaves peptides in various proteins in a process that requires ATP hydrolysis. Has a chymotrypsin-like activity. Plays a major role in the degradation of misfolded proteins (By similarity)(COG0740) |
Kegg | Link to kegg annotations (AT1G49970) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019441509.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |