Ll_transcript_80029

• Id Trinity: FTRINITY_DN58160_c1_g1_i10
• Name Transcript: Ll_transcript_80029
• Sequence: TGTGACAAGTCTCTCACATCCAACTTCCTCATATAGAGCATCATGGTGAATTCTCTTAGTGGATGGTTTTACTTGTAAACTGCTTTTAATTGCAACAAAG TTGTATCTCCCAAAAATCAACAGATCAAGTGGTGCTGTTATAGATATGTGGATTGAGGCAAAAGAGCTGGAGGCAAATACAATGTGATAGATTTGATCAT GATCACAACATTCTCTATAGCACTCCTTTGTGTCACTTTTCCCTTTTATGATGTGCTTCATTTGACACCGTAGGTTGTGTCTACAAATTATCTAATCTTT CATAATTGTAGTTTACTTGTTTTTAGTGTTCACATGTGAGAAGTGAACAATTGCATAGTAGAAATGATGGATGAAATTACTCTTTCCAAAATGGG
• Tissue: flowers
• Gene name: LI_gene_74681;
• Additional information: -

Expression of Ll_transcript_80029

FPKM

• FPAB: 5.5
• FPNAB: 1.4
• LF1: 3.8
• LF2: 12.3
• LF3: 10.1
• LF4: 8.5
• UF1: 5.9
• UF2: 11.1
• UF3: 8.7
• UF4: 4.3

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_80029

• Blastp: -
• Blastx: ATP-dependent Clp protease proteolytic subunit-related protein 1, chloroplastic from Arabidopsis with 83.33% of identity
• Eggnog: Cleaves peptides in various proteins in a process that requires ATP hydrolysis. Has a chymotrypsin-like activity. Plays a major role in the degradation of misfolded proteins (By similarity)(COG0740)
• Kegg: Link to kegg annotations (AT1G49970)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019441509.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;