Ll_transcript_80492

• Id Trinity: FTRINITY_DN58180_c1_g2_i13
• Name Transcript: Ll_transcript_80492
• Sequence: CAGTAAGAAACCAACAGAACAATTGGATGTGTACAGCTTTGGTGTTGTATTGCTAGAGCTAGTGAGTGGAAGACAAGCAGAGGCAACAGAGTCAAATGAT GCCTCACTTGACATAGTAAAATGGGTTAGAAGGAAAGTAAACATAACTAATGGGGTGCAACAAGTTCTTGACCCTAGAATATCACATACTTATCACCAAG CAATGATTGGAGCATTAGATA
• Tissue: flowers
• Gene name: LI_gene_74854;
• Additional information: -

Expression of Ll_transcript_80492

FPKM

• FPAB: 4.7
• FPNAB: 0.7
• LF1: 1.2
• LF2: 4.5
• LF3: 9.2
• LF4: 10.5
• UF1: 1.3
• UF2: 0.7
• UF3: 0.6
• UF4: 2.2

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_80492

• Blastp: -
• Blastx: Probably inactive leucine-rich repeat receptor-like protein kinase At5g06940 from Arabidopsis with 66.13% of identity
• Eggnog: leucine Rich Repeat(COG4886)
• Kegg: Link to kegg annotations (AT5G06940)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019426200.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;