Id Trinity | FTRINITY_DN58196_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_79972 |
Sequence | TAGAAAGTATGCTATGAGTGAAGTTTTCCAATAAAATACATTTTATATGCAATATATATATGTTTGCATGCATGTGTGTGTATTTTCTCTTAAAAGTGAG GTTGGACTTGGAATAAGTTTATGCTCTAACTGTTTGCTCTTGCTGTGAATGCAGGCAAGACTTTGCGACACCTGCCAAGAATTGCCAGAAGCTCACTTTT ATTATTATGCTCATCATAATAAGCAGCTTACTATACAAGTCAAAC BLAST |
Tissue | flowers |
Gene name | LI_gene_74999; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_79972
Blastp | - |
---|---|
Blastx | Putative 1-phosphatidylinositol-3-phosphate 5-kinase FAB1D from Arabidopsis with 74.19% of identity |
Eggnog | Prevents misfolding and promotes the refolding and proper assembly of unfolded polypeptides generated under stress conditions (By similarity)(COG0459) |
Kegg | Link to kegg annotations (AT1G34260) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019442009.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |