Id Trinity | FTRINITY_DN58225_c2_g1_i10 |
---|---|
Name Transcript | Ll_transcript_120439 |
Sequence | CAGAACCTACTGTTATTATGTATATATTCATGTTCAACTTTGCTAAAAGTAGACCAGAGTTGGGTTCAAAGCTCTTTCTTGCATGGTCTGGATGGGACTC ATTAATGAGTTTCATATACCTGAGAGAGCAGACCAAACATCAATAGAGTTTCAATCTTCATGGAGATTTGGAAATGGCATGTTTGCTTTGATTCTATCCT TTGGCCTTCTACTTACAGCATTGAAAAGCCGAAAAGCTAG BLAST |
Tissue | flowers |
Gene name | LI_gene_75257; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_120439
Blastp | - |
---|---|
Blastx | Boron transporter 1 from Arabidopsis with 58.57% of identity |
Eggnog | solute carrier family 4(ENOG410XPHD) |
Kegg | Link to kegg annotations (AT2G47160) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_020976450.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |