Ll_transcript_120749

Id TrinityFTRINITY_DN58235_c0_g2_i12
Name TranscriptLl_transcript_120749
SequenceGGTCTAAATAGTCCCTTGCATTGGGAGTTTCTTCAGAGATCTGAAAGAGTTCTTCTGTCTGTCATTGCAGATTCTAGAGTTATGAGTTTTCTTCCTTCAA TATTGGCTGCTGCTACAATGATTCATGTTGTTAAAGAGATGGATCCATTTAATGCAATGGAATGCAGAACTCAACTTCTGGCTTTACTCAAAACTACTGA GGAACAAGTGAATGAGTGCTACAAACTCATACTGAAACTATTATTTTGCCATGAAGGCGTTCATAATCTCGGGCAGAAGCGCAAATGCTTATCTGGACCA ACTAACTCAGGTGGTAGTGTCGTGGATGCACCGTTCCGTTAT BLAST
Tissueflowers
Gene nameLI_gene_75338; 
Additional informationdetails; 

Expression of Ll_transcript_120749

Labels

FPAB abscising flower pedicels
FPNAB    non-abscising flower pedicels
LF1 lower flowers stage 1
LF2 lower flowers stage 2
LF3 lower flowers stage 3
LF4 lower flowers stage 4
UF1 upper flowers stage 1
UF2 upper flowers stage 2
UF3 upper flowers stage 3
UF4 upper flowers stage 4

Annotations of Ll_transcript_120749

BlastpCyclin-D3-1 from Arabidopsis with 48.75% of identity
BlastxCyclin-D3-1 from Arabidopsis with 48.75% of identity
Eggnog(DC) complex that phosphorylates and inhibits members of the retinoblastoma (RB) protein family including RB1 and regulates the cell-cycle during G(1) S transition. Phosphorylation of RB1 allows dissociation of the transcription factor E2F from the RB E2F complex and the subsequent transcription of E2F target genes which are responsible for the progression through the G(1) phase. Hypophosphorylates RB1 in early G(1) phase. Cyclin D-CDK4 complexes are major integrators of various mitogenenic and antimitogenic signals. Also substrate for SMAD3, phosphorylating SMAD3 in a cell-cycle-dependent manner and repressing its transcriptional activity. Component of the ternary complex, cyclin(ENOG410XRKC)
KeggLink to kegg annotations (AT4G34160)
CantataDB-
Mirbase-
Ncbi proteinLink to NCBI protein (XP_019422652.1)
PfamCyclin, C-terminal domain (PF02984.18)
Rfam-
GOLinks to GO: General; Genes and gene products; Annotations; Ontology;
Links to GO: General; Genes and gene products; Annotations; Ontology;