Ll_transcript_118215

• Id Trinity: FTRINITY_DN58243_c0_g1_i22
• Name Transcript: Ll_transcript_118215
• Sequence: TATGTCAAGCAAAACCTGTTTAGCAATTTGATCAGTCACCCAAAATTCATTTCTGACACCAAATCAGCAATATCTGATGCATATAACCATACCGACTCCG AGTTTCTGAAATCAGAACATAGTCATAACAGAGATGCTGGGTCAACTGCTTCCACTGCCATTCTAGTTGGTGACCGCTTGCTTGTAGCAAATGTTGGGGA CTCCAGAGCTGTTATATGCAGGGGTGGTAATGCCATTGCTGTTTCTCGAGATCACAAGCCAGACCAAAGTGATGAGAGGCAAAGGATTGAAGATGCAGGC GGCTTTGTCATGTGGGCTGGAACTTGGAGAGTTGGTGGAGT
• Tissue: flowers
• Gene name: LI_gene_75414;
• Additional information: details;

Expression of Ll_transcript_118215

FPKM

• FPAB: 39.5
• FPNAB: 30.8
• LF1: 23.5
• LF2: 24.8
• LF3: 21.8
• LF4: 24.4
• UF1: 18.4
• UF2: 24.5
• UF3: 24.5
• UF4: 21.8

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_118215

• Blastp: Probable protein phosphatase 2C 59 from Arabidopsis with 93.81% of identity
• Blastx: Probable protein phosphatase 2C 59 from Arabidopsis with 93.81% of identity
• Eggnog: Phosphatase(COG0631)
• Kegg: Link to kegg annotations (AT4G31750)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019437814.1)
• Pfam: Protein phosphatase 2C (PF00481.20)
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;
  Links to GO: General; Genes and gene products; Annotations; Ontology;