Id Trinity | FTRINITY_DN58316_c0_g2_i6 |
---|---|
Name Transcript | Ll_transcript_210345 |
Sequence | AGAAGATGGCAGAGGATATGATTCTTGATTTTTCTTTTAATTTTAAGATGGCAGTGATGATTCTGATATACTTCAATGTGATTGGATCAGATCCTGAGGG CAGATTAGGTGAGGCTCCAAGACCTGAACTGCGAGAGCATGGTCGAATTTCAGGTGCCTGCTTTGATGCAGCTCGTGGCATTACGTCTGGCTTAAAGGTT AGAGGAACAGACTATAAGACATCCGACGGGACATGCATAAGAGATTATATTGATGTAACTGACCTGGTTGATGCTCACGTCAAAGCTCTTGAAAAGGCGC AACCTGCTAAAGTCGGGATCTACAATGTTGGCACCGGAAA BLAST |
Tissue | flowers |
Gene name | LI_gene_76015; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_210345
Blastp | UDP-arabinose 4-epimerase 1 from Arabidopsis with 88.66% of identity |
---|---|
Blastx | UDP-arabinose 4-epimerase 1 from Arabidopsis with 86.61% of identity |
Eggnog | udp-glucose 4-epimerase(COG1087) |
Kegg | Link to kegg annotations (AT1G30620) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019426467.1) |
Pfam | NAD dependent epimerase/dehydratase family (PF01370.20) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |