| Id Trinity | FTRINITY_DN58338_c1_g2_i5 |
|---|---|
| Name Transcript | Ll_transcript_212737 |
| Sequence | AAGGCTTACCAGGCACCAGGGTATATATCAATAGATGACTATTTATTGGGGTGCTGCTGTTCTATACAAAGATAACAACCAAACTCTGTCTAAAAGCAAG GATATACCACCAGTGAATAGAACACTGAATGGTCCTGATAAATGGATGAATGTACTATGTAAGAAATTGGTTACGTGGTGGCAATGGGTTGCTGTCGGGA AGATTCCACTCATGCCATCTAAAGGGAAAATGATGATGCAAGTATGTCTAATACACCTTTGGGTGCAAGTTAATCATCCGGAGCCAGCAATATTTAGGAT CTTTTTTATGTATTTTGTTTTTAAAGTGTTATATGAGACTACTTGAGTTTTTGAGATTTTATGATGTATT BLAST |
| Tissue | flowers |
| Gene name | LI_gene_76193; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_212737
| Blastp | DDT domain-containing protein DDR4 from Arabidopsis with 43.18% of identity |
|---|---|
| Blastx | DDT domain-containing protein DDR4 from Arabidopsis with 43.18% of identity |
| Eggnog | Aminoacyl-t-RNA synthetase(ENOG410Z49E) |
| Kegg | Link to kegg annotations (AT1G18950) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019414642.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |