Id Trinity | FTRINITY_DN58341_c1_g3_i1 |
---|---|
Name Transcript | Ll_transcript_210758 |
Sequence | TGGAAATTAACTTGAAAGCATTCATGGATGTTGGTTGCTGTTCCTTCTTCTCTGTCACATGGTGATTTTCGCAATCTTTAAAGACAGCTTCTACATCATC CAGGCTGGTTTCCGCTTTCTCGATGAAAACCGGAGGCTTATAATCTATCTTAAACCATTCATTGTCCAATATCTCAGCTACAGTTATACGAGTCACGGGA TTGGGATCCAAGATTCGAGATATCAATTTCCTAGCACTGAAAGAAAGCCATGGGGGGCAAGTGAATTCTGCAGCCGAGATTTTTTTATACAAGTCGATAA GATTAGGACCATCGAAAGGTAAGâBLAST |
Tissue | flowers |
Gene name | LI_gene_76217; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_210758
Blastp | CBL-interacting serine/threonine-protein kinase 26 from Arabidopsis with 69.16% of identity |
---|---|
Blastx | CBL-interacting serine/threonine-protein kinase 26 from Arabidopsis with 69.16% of identity |
Eggnog | Serine Threonine protein kinase(COG0515) |
Kegg | Link to kegg annotations (AT5G21326) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019434424.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |