| Id Trinity | FTRINITY_DN58366_c0_g1_i11 |
|---|---|
| Name Transcript | Ll_transcript_211269 |
| Sequence | ACAAAGAAGCATTGCTAACTATAATGAATGTCCTCTCCAGGTTTTTATCCATGATCCTCTTTATAAGTGGGCTCTATCCCCTCTGAAAGCTTTGCAACGC CAAAAGGATATGGATGATGATTTGGTTACAAGCTTGGAAGATCCTCAAAATGATTATGAAGGAAATAAGGATGCCGCACGTGCACTTCTACGCGTCAAGC AAAAGCTAGATGGATATGAAGAAGGTGAAATGCGCAGCATCCACGGACAGGTCCAACAACTCATCCAAGATGCAATAGATTCTGAGCGGTTGTGTCAAAT GTTTCCTGGTTGGGGAGC BLAST |
| Tissue | flowers |
| Gene name | LI_gene_76465; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_211269
| Blastp | Serine/threonine-protein kinase ATM from Arabidopsis with 75.53% of identity |
|---|---|
| Blastx | Serine/threonine-protein kinase ATM from Arabidopsis with 75.53% of identity |
| Eggnog | ataxia telangiectasia mutated(ENOG410XNPY) |
| Kegg | Link to kegg annotations (AT3G48190) |
| CantataDB | Link to cantataDB annotations (CNT0001712) |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019416968.1) |
| Pfam | FATC domain (PF02260.19) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |