Id Trinity | FTRINITY_DN58366_c0_g1_i11 |
---|---|
Name Transcript | Ll_transcript_211269 |
Sequence | ACAAAGAAGCATTGCTAACTATAATGAATGTCCTCTCCAGGTTTTTATCCATGATCCTCTTTATAAGTGGGCTCTATCCCCTCTGAAAGCTTTGCAACGC CAAAAGGATATGGATGATGATTTGGTTACAAGCTTGGAAGATCCTCAAAATGATTATGAAGGAAATAAGGATGCCGCACGTGCACTTCTACGCGTCAAGC AAAAGCTAGATGGATATGAAGAAGGTGAAATGCGCAGCATCCACGGACAGGTCCAACAACTCATCCAAGATGCAATAGATTCTGAGCGGTTGTGTCAAAT GTTTCCTGGTTGGGGAGC BLAST |
Tissue | flowers |
Gene name | LI_gene_76465; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_211269
Blastp | Serine/threonine-protein kinase ATM from Arabidopsis with 75.53% of identity |
---|---|
Blastx | Serine/threonine-protein kinase ATM from Arabidopsis with 75.53% of identity |
Eggnog | ataxia telangiectasia mutated(ENOG410XNPY) |
Kegg | Link to kegg annotations (AT3G48190) |
CantataDB | Link to cantataDB annotations (CNT0001712) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019416968.1) |
Pfam | FATC domain (PF02260.19) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |