Id Trinity | FTRINITY_DN58399_c6_g1_i9 |
---|---|
Name Transcript | Ll_transcript_212443 |
Sequence | CAGTTGGCTGATGCAAAGGTTGTAATGAAAGCAGTGCAGCACTTGGACGGAATCAGATTGCCAGTTCTGACTCCTAATTTGAAGGTGCATATTTCTTGAA TAACCTTAAATTGGCAGAGTTATGTTCAAATCTGACCTTTAAATTTTTAGGGGTTTGAAGCTGCCGTGGCAGCTGGTGCTAGGGAAGTAGCTGTTTTTGC ATCAGCTTC BLAST |
Tissue | flowers |
Gene name | LI_gene_76757; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_212443
Blastp | - |
---|---|
Blastx | Hydroxymethylglutaryl-CoA lyase, mitochondrial from Arabidopsis with 82.14% of identity |
Eggnog | Catalyzes the condensation of the acetyl group of acetyl-CoA with 3-methyl-2-oxobutanoate (2-oxoisovalerate) to form 3-carboxy-3-hydroxy-4-methylpentanoate (2-isopropylmalate) (By similarity)(COG0119) |
Kegg | Link to kegg annotations (AT2G26800) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019432091.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |