Ll_transcript_30437

• Id Trinity: FTRINITY_DN58408_c2_g3_i14
• Name Transcript: Ll_transcript_30437
• Sequence: CACAAAACTACAAAACTATTCCTTCAATTCATCATCATCATCATCTTATAAAACATAAAAAAACAGTGATTTATTTCAAGGTTGTGTGTGTTGTGAAATC TTGTTGTGTCAGAATTGGAAAGTTGAGTTTTTTAGTAGTGTGGAAATTATAGAGATGGGAGAGAGTGAAGTGATTCATTCATGGTCTGCTCCTAGATCCC TTAGTACTAGTCTCATGTATTCTTTTGCTCAGCGAACCGCGAATTTGGGTCTCCCGTTCTTTTGCGAACTGATTCTC
• Tissue: flowers
• Gene name: LI_gene_76856;
• Additional information: -

Expression of Ll_transcript_30437

FPKM

• FPAB: 0
• FPNAB: 0
• LF1: 0
• LF2: 0.3
• LF3: 1.3
• LF4: 0
• UF1: 0
• UF2: 0
• UF3: 0
• UF4: 0

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_30437

• Blastp: -
• Blastx: Branched-chain-amino-acid aminotransferase-like protein 1 from Arabidopsis with 92.59% of identity
• Eggnog: brancheD-chain amino acid aminotransferase(COG0115)
• Kegg: Link to kegg annotations (AT3G05190)
• CantataDB: Link to cantataDB annotations (CNT0001957)
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019419837.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;