| Id Trinity | FTRINITY_DN58422_c1_g1_i24 |
|---|---|
| Name Transcript | Ll_transcript_31862 |
| Sequence | ATGGATTCCCGATAGTTACTTTTATTGACACGCCTGGGGCATATGCTGACCTTAAATCAGAGGAAAAGGGCCAGGGTGAAGCTATTGCCCATAATTTGAG ATCCATGTTTGGTCTAAAGGTGCCAGTTGTGTCAATAGTTATTGGAGAAGGTGGTTCTGGTGGTGCACTTGCCATTGGATGTGCTAATAAATTGCTTATG CTTGAAAATGCTGTTTTCTATGTCGCTAGTCCGGAGGCATGTGCAGCAATCTTGTGGAAGAGTGCTAAAGCTGCTCCTAAGGCCGCTGAAAAACTGAAGA TTACAGCCTCTGAATTGTGCCGATTGGAAGTTGCAGATGGTGTTATCCCTGAACCACTTGGCGGTGCACATGCTGATTCAGCTTGGACTTCACAACAGAT AAAAAATGCAAT BLAST |
| Tissue | flowers |
| Gene name | LI_gene_76927; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_31862
| Blastp | Acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha, chloroplastic from Arabidopsis with 86.57% of identity |
|---|---|
| Blastx | Acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha, chloroplastic from Arabidopsis with 86.57% of identity |
| Eggnog | Component of the acetyl coenzyme A carboxylase (ACC) complex. First, biotin carboxylase catalyzes the carboxylation of biotin on its carrier protein (BCCP) and then the CO(2) group is transferred by the carboxyltransferase to acetyl-CoA to form malonyl-CoA (By similarity)(COG0825) |
| Kegg | Link to kegg annotations (AT2G38040) |
| CantataDB | Link to cantataDB annotations (CNT0002886) |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019450295.1) |
| Pfam | Carboxyl transferase domain (PF01039.21) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |