Id Trinity | FTRINITY_DN58422_c1_g1_i26 |
---|---|
Name Transcript | Ll_transcript_31864 |
Sequence | TTCATTGACACGCCTGGGGCTTATGCTGACCTTAAATCAGAGGAACTAGGCCAGGGTGAAGCAATTGCCCATAATTTGAGATCCATGTTTGGTCTGAAGG TGCCAGTTGTGTCGATAGTTATTGGAGAAGGCGGTTCTGGTGGTGCGCTTGCCATTGGATGCGCTAATAAATTACTTATGCTTGAAAATGCTGTTTTTTA TGTTGCCAGTCCGGAGGCATGTGCAGCAATCTTGTGGAAGAGTGCTAAAGCTGCTCCTAAGGCCGCTGAAAAACTGAAGATTACAGCCTCTGAATTGTGC CGATTGGAAGTTGCAGATGGTGTTATCCCTGAACCACTTGGCGGTGCACATGCTGATTCAGCTTGGACTTCACAACAGATAAAAAATGCAAT BLAST |
Tissue | flowers |
Gene name | LI_gene_76927; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_31864
Blastp | Acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha, chloroplastic from Arabidopsis with 86.72% of identity |
---|---|
Blastx | Acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha, chloroplastic from Arabidopsis with 86.72% of identity |
Eggnog | Component of the acetyl coenzyme A carboxylase (ACC) complex. First, biotin carboxylase catalyzes the carboxylation of biotin on its carrier protein (BCCP) and then the CO(2) group is transferred by the carboxyltransferase to acetyl-CoA to form malonyl-CoA (By similarity)(COG0825) |
Kegg | Link to kegg annotations (AT2G38040) |
CantataDB | Link to cantataDB annotations (CNT0002886) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019450295.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |