Id Trinity | FTRINITY_DN58503_c2_g6_i1 |
---|---|
Name Transcript | Ll_transcript_7628 |
Sequence | CAAAACCTTACATAGTCACATATCTTCCTCTTCAATCATTAGCTAATAATATGGCTTTCATGCTAATGCTTTTTCTTCTACTTACTGGTCTAGAGATGCT TCCTGTTCTTGGTATTTTGGATGCAACAGCTGAACAATCCTTAGGAGTTTGTTATGGACAAGTAGCTAATAACTTACCTCCTGCACCAGAAGTAATAGCT CTTTTCAATCAAAATGGCATTGGTAGAATGAGAATATATAACCCTAATATACCAACAATTGAAGCACTGAAAGGATCAGCCATAAAACTTTCTGTTGGGG TCCCTAATGAGATAATTCAATCCCTTGCTACAGATGCTGCTGCAGCAACTCAATGGGTCCAAACCAATATAATAACATATGCTAAAGATGTTAAATTTCA ATACATTGTTGTTGGGAATGAAATAATGCCTGGTAATACAACAGGACCATATGTTGCACCAAAACTAACATTGGCTTGGCATCATGCTTCTAACTTG BLAST |
Tissue | flowers |
Gene name | LI_gene_77619; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_7628
Blastp | Glucan endo-1,3-beta-glucosidase, acidic isoform GI9 from Nicotiana with 46.43% of identity |
---|---|
Blastx | Glucan endo-1,3-beta-glucosidase, acidic isoform GI9 from Nicotiana with 53.98% of identity |
Eggnog | - |
Kegg | - |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019454307.1) |
Pfam | Glycosyl hydrolases family 17 (PF00332.17) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |