Id Trinity | FTRINITY_DN58524_c3_g6_i1 |
---|---|
Name Transcript | Ll_transcript_7714 |
Sequence | TGCTGCAGCATATGCACATGAACGGCCACACTTCGGTCTTGAAGTAGGTCTTACAAACTATGCCGCAGCTTATTGCACTGGGCTTCTTCTGGCCCGTAGA GTCCTCAAGACACTTGAATTGGATGAGGATTATGAGGGGAATGTAGAGGCTACAGGAGAGGATTATTCTGTTGAACCTGCTGAGACCAGGAGACCATTCC GTGCTCTCCTTGATGTTGGTCTTATTAGGACCACAACTGGAAATCGTGTTTTTGGTGCCCTCAAGGGAGCATTGGATGGGGGTTTGGATATTCCCCACAG TGACAAAAGGTTTGCTGGTTATGATAAGGAGAAGAAGGAACTGGATCCCGAGGTTCACCGCAAATATATCTTTGGTGGACATGTTGCTAACTATATTAAG ACCTTGATCGAAGATGAACCTGAGAAATATCAAACACACTTTAGTGAATACATCAAGCGAGGAATAGAG BLAST |
Tissue | flowers |
Gene name | LI_gene_77788; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_7714
Blastp | 60S ribosomal protein L5 from Cucumis with 85.9% of identity |
---|---|
Blastx | 60S ribosomal protein L5 from Cucumis with 85.9% of identity |
Eggnog | - |
Kegg | Link to kegg annotations (101216379) |
CantataDB | Link to cantataDB annotations (CNT0000907) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019460221.1) |
Pfam | Ribosomal large subunit proteins 60S L5, and 50S L18 (PF17144.3) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |