Id Trinity | FTRINITY_DN58551_c0_g1_i11 |
---|---|
Name Transcript | Ll_transcript_5121 |
Sequence | CGAGTTTGTGCAAAAATATCTTGGTGAGGGTCCACGTATGGTTCGTGATGTATTTCGTCTTGCAAAAGAGAATGCCCCCGCAATTATATTTATTGATGAG GTTGATGCAATTGCTACTGCTAGATTCGATGCCCAAACTGGAGCTGATAGGGAAGTCCAACGTATCCTCATGGAACTTTTGAATCAGATGGATGGGTTTG ACCAAACTGTGAATGTTAAAGTCATAATGGCAACTAATCGGGCAGACACTCTGGACCCTGCTCTTCTGCGTCCTGGAAGACTTGATCGGAAGATTGAGTT CCCTTTGCCTGATAGACGCCAAAAGAGGCTTGTATTTCAGGTTTGCACAGCCAAAATGAATTTGGGTGATGAGGTGGACCTGGAAGATTATGTGTCTCGT CCAGACAAAATTAGTGCTGCAGAGATATCAGCCATTTGTCAAGAAGCAGGAATGCA BLAST |
Tissue | flowers |
Gene name | LI_gene_78013; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_5121
Blastp | 26S proteasome regulatory subunit 6B homolog from Solanum with 99.34% of identity |
---|---|
Blastx | 26S proteasome regulatory subunit 6B homolog from Solanum with 99.34% of identity |
Eggnog | 26S protease regulatory subunit(COG1222) |
Kegg | Link to kegg annotations (102577768) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019419657.1) |
Pfam | ATPase family associated with various cellular activities (AAA) (PF00004.28) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |