Ll_transcript_7474

• Id Trinity: FTRINITY_DN58556_c4_g2_i11
• Name Transcript: Ll_transcript_7474
• Sequence: CAGTAGTCCTAGCCGTAAACGATGGATACTAGGCGTTGTGTGTATCGACCCGTGCAATGCTGTAGCTAACGCTAGGGAAGAAAATAGATTTATGAATGGA ATAAAATATGCAGTATTTACAGACAAAAGTATTCGGTTATTGGTGAAAAATCAATATACTTCTAATGTCGAATCGGGATCAACTAGGACAGAAATAAAGC ATTGGGTCGAACTCTTCTTTGGTGTCAAGGTAATAGCTATGAATAGTCATCGACTACTTTCTACTTCTACAGATCCTGCTCCAAATGATTTTGATCTTCC TGACCATACTTCCAAGTGATCTCCGAAAATGGCGTTCCGTTTGAAGAAAGGAAGAATCCCAACAAAGAATCAATCTTTCTTTTAGTTGTTG
• Tissue: flowers
• Gene name: LI_gene_78058;
• Additional information: details;

Expression of Ll_transcript_7474

FPKM

• FPAB: 0.2
• FPNAB: 0
• LF1: 0.7
• LF2: 0
• LF3: 0.2
• LF4: 0.1
• UF1: 1.1
• UF2: 0
• UF3: 0.3
• UF4: 0

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_7474

• Blastp: 50S ribosomal protein L23, chloroplastic from Nicotiana with 85.94% of identity
• Blastx: 50S ribosomal protein L23, chloroplastic from Nicotiana with 85.94% of identity
• Eggnog: -
• Kegg: Link to kegg annotations (800421)
• CantataDB: Link to cantataDB annotations (CNT0000963)
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_003605908.1)
• Pfam: Ribosomal protein L23 (PF00276.19)
• Rfam: SSU_rRNA_archaea (RF01959)
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;
  Links to GO: General; Genes and gene products; Annotations; Ontology;