Id Trinity | FTRINITY_DN58559_c1_g3_i13 |
---|---|
Name Transcript | Ll_transcript_5958 |
Sequence | ATACGTTTCACAGCTTTTCTAAACTTCTCTTTTGTTTGGTTCTCAAGTTCATGGGTTTTTATTTCCATAGTGGTTGGTACAAAAGGCATAAATGCTATTT CCTATCATGGTTATTAGGTTGTTGAGCATGGCCTTGGCCATCTGCCATTCGTTGAGAAGCAAGTAGTTACTCCGACAGGATCTGTCTACACCGGTGTTGA CTTCT BLAST |
Tissue | flowers |
Gene name | LI_gene_78085; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_5958
Blastp | - |
---|---|
Blastx | Uridine kinase-like protein 5 from Arabidopsis with 89.66% of identity |
Eggnog | Catalyzes the conversion of uracil and 5-phospho-alpha- D-ribose 1-diphosphate (PRPP) to UMP and diphosphate (By similarity)(COG0035) |
Kegg | Link to kegg annotations (AT3G27440) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_013448035.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |