Ll_transcript_7327

• Id Trinity: FTRINITY_DN58562_c0_g1_i1
• Name Transcript: Ll_transcript_7327
• Sequence: GAAATTCTGAAGATTCATGCTGCTGGAATCGCTAAGCATGGTGAAATAGACTATGAAGCTGTTGTGAAGCTTGCCGAGGTGAGCCCAGTGCTTTGGGTTA GTTTTACAATCAATTTTATGCTTGTCTGATGTATTGTCTGTTGCAAATTAAATTACCCAGGGATTTAATGGGGCTGATCTTCGAAATGTGTGCACGGAGG CTGGAATGTCAGCTATTCGTGCAGAGCGTGATTATGTGATCCA
• Tissue: flowers
• Gene name: LI_gene_78107;
• Additional information: -

Expression of Ll_transcript_7327

FPKM

• FPAB: 0
• FPNAB: 0.5
• LF1: 0
• LF2: 0.5
• LF3: 0.5
• LF4: 0.4
• UF1: 0
• UF2: 0
• UF3: 0
• UF4: 0.8

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_7327

• Blastp: -
• Blastx: 26S proteasome regulatory subunit 10B homolog A from Arabidopsis with 83.33% of identity
• Eggnog: 26S protease regulatory subunit(COG1222)
• Kegg: Link to kegg annotations (AT5G43010)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_015969675.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;