Id Trinity | FTRINITY_DN58577_c4_g1_i11 |
---|---|
Name Transcript | Ll_transcript_5056 |
Sequence | GTTAGAATACAATTGAGAGTACCAGAATATGGTTGGACAACGCAGAAGCTCTTTCACTTTCTCAATTTTTTCGTCAATGCAGGTTTCCTTTTACCATTCA ATTTTCCCCTTTTATGGTTTTATTTATTTATTTCTTCTATGAATGTTTATTCTGCTAATAATTAATGTATGCTCTTTCCAATTTTGCAGTTCGATGTTCC GTTTTCATTTTTCGTCGCGACGTGCACAAGTTGCAACCAGC BLAST |
Tissue | flowers |
Gene name | LI_gene_78233; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_5056
Blastp | - |
---|---|
Blastx | Protein TOM THREE HOMOLOG 1 from Arabidopsis with 88.89% of identity |
Eggnog | tobamovirus multiplication(ENOG41110A4) |
Kegg | Link to kegg annotations (AT1G14530) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019458728.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |