| Id Trinity | FTRINITY_DN58598_c2_g1_i13 |
|---|---|
| Name Transcript | Ll_transcript_7945 |
| Sequence | AGTTTGTTATCGTCCGAGGAAGCTGTTATTTTCGTTGTTTCCACCACTGGTCAAGGTGTTTTGGAAGTTTCTTCTTCAGAGAAACCTCACTAGTTCTTGG CTTAAAGGGGTTCATTATGCTGTTTTTGGTTTGGGTGATTCTAGTTACCCCAAGTACAATTTTGTTGCGAAGAAGCTCGACAAGAGATTAATGGACCTTG GAGGAACACCTATTGTGGAAAGAGGCTTGGGAGATGATCAGCACCCTTCCGGTTATGAAGGTTCTTTGGATCCATGGATGTCTTCTCTTTGGAGAATGTT ATATATGATTAAACCAGAATTCTTCCCAAATGGTCCTGATGTTGTGATTCTAGATACAGTTTTGATTGATCAACCTAAAGTGCAAATCATATATCACAAC ATTGAAACTTTAGAGTCACATTTTTCTACTGCCTTAGATTTAACACGTCTTGAGATCCAAGTTGGGAGTGCTCGTTCATTGCATCCGGGTAAATCATCTC CTGACAGAAGTAGGCCTGACTGCTTTCTTAAGATGGTCAAGAATCTTCCTTTGACCA BLAST |
| Tissue | flowers |
| Gene name | LI_gene_78440; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_7945
| Blastp | NADPH-dependent diflavin oxidoreductase 1 from Arabidopsis with 59.88% of identity |
|---|---|
| Blastx | NADPH-dependent diflavin oxidoreductase 1 from Arabidopsis with 59.88% of identity |
| Eggnog | Component of the sulfite reductase complex that catalyzes the 6-electron reduction of sulfite to sulfide. This is one of several activities required for the biosynthesis of L- cysteine from sulfate. The flavoprotein component catalyzes the electron flow from NADPH - FAD - FMN to the hemoprotein component (By similarity)(COG0369) |
| Kegg | Link to kegg annotations (AT3G02280) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019452079.1) |
| Pfam | Flavodoxin (PF00258.24) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |