Id Trinity | FTRINITY_DN58598_c2_g1_i18 |
---|---|
Name Transcript | Ll_transcript_7952 |
Sequence | ATATGTTTCATTCTTTGTATTCTTATTTCGTGCTTTCTACAGACTTTGTTGTCGTTCGAGGAAGCTGTTATTTTTGTTGTTTCTACCACTGCTCAAGGTG ACACACCTGATTCCATCAAGGTGTTTTGGAAGTTTCTTCTTCAGAGAAACCTCACTAGTTCTTGGCTTAAAGGGGTTCATTATGCTGTTTTTGGTTTGGG TGATTCTAGTTACCCCAAATACAATTTTGTTGCGAAGAAGCTGGACAAGAGATTAATAGACCTTGGAGGAACACCTATTGTGGAAAGAGGCTTGGGAGAT GATCAGCATCCTTCCGGATTTAACACATCTTGATATTCAACTTGAGAGTACTCGTTTATTGCATCCGGGTAAATCATCTCCTGACAGAAGTAGGCCTGAC TGCTTTCTTAAGATGGTCAAAAATCTTCCTTTGACCAGGTCAAA BLAST |
Tissue | flowers |
Gene name | LI_gene_78440; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_7952
Blastp | NADPH-dependent diflavin oxidoreductase 1 from Arabidopsis with 74.19% of identity |
---|---|
Blastx | NADPH-dependent diflavin oxidoreductase 1 from Arabidopsis with 73.4% of identity |
Eggnog | Component of the sulfite reductase complex that catalyzes the 6-electron reduction of sulfite to sulfide. This is one of several activities required for the biosynthesis of L- cysteine from sulfate. The flavoprotein component catalyzes the electron flow from NADPH - FAD - FMN to the hemoprotein component (By similarity)(COG0369) |
Kegg | Link to kegg annotations (AT3G02280) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019452078.1) |
Pfam | Flavodoxin (PF00258.24) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |