Id Trinity | FTRINITY_DN58622_c1_g1_i4 |
---|---|
Name Transcript | Ll_transcript_178986 |
Sequence | TGAAAATGATCCCAAATCTCATGAAGGGATGAACCTTAACCAAGTTACAGCAAAAGAACTCATTTCGAAATATGGGTTGGATGACAACACAATTGACTTC ATTGGCCATGCATTGGCTCTACATTTGGATGATGAATACTTAACTCAGCCTGCAATGGATTTTGTAAAAAGAATGAAGCTATATGCAGAATCCTTAGCAC GTTTTCAGGGTGGATCTCCTTATATTTATCCACTCTATGGACTGGGAGAGCTTCCTCAGGGATTTGCTCGTTTGAGTGCTGTTTATGGTGGCACCTACAT GCTGAACAAGCCAGAATGCAAGGTTGAGTTTGATGAGAGTGGAAAGGCCATAGGTGTGACATCTGAAGGAGAAACAGCAAAATGCAAAAAAGTTGTTTGT GACCCTTCATACTTACCAGACAAGGTGAAGAAGGTTGGAAAAGTGAATCGCGCTATTTGTATTATGAGTCATCCTATCCCAAACACCCACGACTCTCCAT CAGTTCAGGTTATTCTGCCTCAGAAACAACTTGGGCGTAAATCA BLAST |
Tissue | flowers |
Gene name | LI_gene_78693; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_178986
Blastp | Guanosine nucleotide diphosphate dissociation inhibitor At5g09550 from Arabidopsis with 85.64% of identity |
---|---|
Blastx | Guanosine nucleotide diphosphate dissociation inhibitor At5g09550 from Arabidopsis with 85.64% of identity |
Eggnog | GDP dissociation inhibitor(COG5044) |
Kegg | Link to kegg annotations (AT5G09550) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019445391.1) |
Pfam | GDP dissociation inhibitor (PF00996.17) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |