Id Trinity | FTRINITY_DN58634_c0_g1_i15 |
---|---|
Name Transcript | Ll_transcript_178244 |
Sequence | ATGGCAGGAGGAGCTCCAGCACCAAAAGCTGATGAACCACAACCACATCCACCAAAAGATCAGTTACCCAATGTTTATTACTGCATTACCAGTCCTCCAC CATGGCCTGAGGCCATACTTCTTGGTTTTCAACACTATCTTGTCATGCTTGGTACAACAGTGCTAATTCCAACGGCTCTTGTTCCCCAGATGGGAGGTGG CAATGAGGAGAAGGCGCAAGTTATCCAAACACTACTCTTCGTAGCTGGAATTAACACATTATTGCAATCACTATTTGGGACTCGATTGCCTGCAGTAATT GGAGGGTCTTATACCTTTGTTCCGACGACAATâBLAST |
Tissue | flowers |
Gene name | LI_gene_78774; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_178244
Blastp | Nucleobase-ascorbate transporter 6 from Arabidopsis with 92.59% of identity |
---|---|
Blastx | Nucleobase-ascorbate transporter 6 from Arabidopsis with 92.59% of identity |
Eggnog | permease(COG2233) |
Kegg | Link to kegg annotations (AT5G62890) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019463856.1) |
Pfam | Permease family (PF00860.19) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |