Id Trinity | FTRINITY_DN58647_c4_g1_i21 |
---|---|
Name Transcript | Ll_transcript_178094 |
Sequence | AAGAAATTTGCCGCGATGTCTACAATGCAGAGCAAGATTGGAAAATAATCTTGTTGAGATACTTCAACCCAGTGGGTGCACATCCTAGTGGTTATATTGG GGAGGACCCTCGAGGAATTCCAAACAATCTCATGCCATTTGTTCAGCAAGTAGCAGTTGGCAGACGCCCGGCATTGACAGTTTTCGGAACTGATTATAAT ACAAGTGATGGCACTGGAGTTCGAGATTACATTCATGTTGTTGATTTAGCAGATGGGCACATTGCTGCATTAAATAAACTAGATGATCCTAAAATAGGAT GTGAAGTTTATAAC BLAST |
Tissue | flowers |
Gene name | LI_gene_78866; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_178094
Blastp | UDP-glucose 4-epimerase GEPI48 from Cyamopsis with 93.27% of identity |
---|---|
Blastx | UDP-glucose 4-epimerase GEPI48 from Cyamopsis with 93.27% of identity |
Eggnog | - |
Kegg | - |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019422623.1) |
Pfam | NAD dependent epimerase/dehydratase family (PF01370.20) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |