| Id Trinity | FTRINITY_DN58648_c0_g1_i6 |
|---|---|
| Name Transcript | Ll_transcript_178775 |
| Sequence | TTGTTTCAATTAGAAGAAGACGTAAAGCTTCTTGAAGAGATGTATCCACAAGGGGAAAAGGTAATCAGATTTCCAACTTTTTAACCGCTTGGCAAAACGT GTAATGTATTTTACACTGGCTTCTCCTGCATGAATGCAGGCTGAGACATCATGGGCACTTACAGTTCTCGGTTATCTGGCAAAACTTGTTTTGGGGATTT TAGGGTTGATTGTGTCAGTGGCTTGGGTTGCTCATATCATTATCTATCTATTAATTGACCCTCCACTTTCTCCTTTCTTGAATGAAGTTTTTATCAAGCT AGATGATGTATGGGGTATGTTGAAATACCCGCTTTTTTTTATCTTTCCTCAGATACTTTTAATGATAGATACGTTACATGATAATATTCATTCAGTTACC TTATTTAGTATATGTATTTTACTCTTTTATCAGGCCTTCTTGG BLAST |
| Tissue | flowers |
| Gene name | LI_gene_78871; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_178775
| Blastp | LIMR family protein At5g01460 from Arabidopsis with 82.86% of identity |
|---|---|
| Blastx | LIMR family protein At3g08930 from Arabidopsis with 77.03% of identity |
| Eggnog | LIMR family(ENOG410XRDU) |
| Kegg | Link to kegg annotations (AT5G01460) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019413976.1) |
| Pfam | LMBR1-like membrane protein (PF04791.15) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |